first commit

Author: danielle-pinto

docs/src/rosalind/09-subs.md

@@ -0,0 +1,118 @@
+# Finding a Motif in DNA
+
+🤔 [Problem link](https://rosalind.info/problems/subs/)
+
+!!! warning "The Problem"
+
+    Given two strings s and t, 
+    t is a substring of s if t is contained as a contiguous collection of symbols in s 
+    (as a result, t must be no longer than s).
+
+    The position of a symbol in a string is the total number of symbols found to its left, including itself.    
+    (e.g., the positions of all occurrences of 'U' in "AUGCUUCAGAAAGGUCUUACG" are 2, 5, 6, 15, 17, and 18).   
+    The symbol at position i of s is denoted by s[i].
+
+    A substring of s can be represented as s[j:k],   
+    where j and k represent the starting and ending positions of the substring in s;    
+    for example, if s= "AUGCUUCAGAAAGGUCUUACG",   
+    then s[2:5]= "UGCU".
+
+    The location of a substring s[j:k]is its beginning position j;   
+    note that t will have multiple locations in s
+    if it occurs more than once as a substring of s.
+    (see the Sample below).
+
+    Given: 
+    Two DNA strings s and t.  
+    (each of length at most 1 kbp).
+
+    Return: 
+    All locations of t as a substring of s.  
+
+    Sample Dataset
+    `GATATATGCATATACTTATAT`
+    
+    Sample Output
+    `2 4 10`
+
+### Handwritten solution
+The clunkiest solution uses a for-loop.   
+We can loop over every character within the input string and  
+check if we can find the substring in the subsequent characters.  
+
+
+```julia
+
+dataset = "GATATATGCATATACTTATAT"
+search_string = "ATAT"
+
+function haystack(substring, string)
+    # check if the strings are empty
+    if isempty(substring) || isempty(string)
+        throw(ErrorException("empty sequences"))
+    end
+
+    # check that string exists in data
+    if ! occursin(substring, string)
+        return []
+    end
+
+    output = []
+
+    for i in eachindex(string)
+        # check if first letter of string matches character at the index
+        if string[i] == substring[1]
+            # check if full 
+            if i + length(substring) - 1 <= length(string) && string[i:i+length(substring)-1] == substring
+                push!(output, i)
+            end
+        end
+    end
+    return output
+end
+
+haystack(search_string, dataset)
+```
+We can also use the [`findnext`](https://docs.julialang.org/en/v1/base/strings/#Base.findnext) function in Julia so that we don't have to loop through every character in the string. 
+
+```julia
+function haystack_findnext(substring, string)
+    # check if the strings are empty
+    if isempty(substring) || isempty(string)
+        throw(ErrorException("empty sequences"))
+    end
+
+    # check that string exists in data
+    if ! occursin(substring, string)
+        return []
+    end
+
+    output = []
+    i = 1
+    # while index is less than the length of string
+    while i < length(string)
+        result = findnext(substring, string, i)
+        if result == nothing
+            break
+        end
+
+        if result != nothing
+            push!(output, first(result))
+            i = first(result) + 1
+        end
+    end
+    return output
+end
+    
+
+haystack_findnext(search_string, dataset)
+```
+
+### Biojulia solution
+
+Lastly, we can leverage some functions in the Kmers Biojulia package to help us!
+
+```julia
+
+
+```